Gene name |
SPAC20H4.04 |
Gene ID |
49/E05 |
Gene synonyms/obsolete |
|
Gene product |
DEAD/DEAH box
helicase; ATP-dependent; RNA helicase; similar to Sp
SPAC9.05 |
Entry clone |
Cloned |
ORF length (unspliced) |
2352 |
ORF length (spliced) |
|
Entry clone length |
2352 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
297A:G / 953A:T /
1220T:C / 1588G:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC20H4.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGTACTGAGAGACTC |
Rev primer name |
SPAC20H4.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGTACTTTGAAATAATGCA |
Amino acid length |
783 |
Molecular weight |
89.4 |
Isoelectric point (calc.) |
9.8 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHNKIQGLSL |
Localization (YFP) |
nucleolus>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |