Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPAPB1E7.02c
Gene ID 49/E08
Gene synonyms/obsolete mcl1
Gene product WD repeat protein; involved in DNA replication; interacts physically with DNA polymerase alpha; involved in sister chromatid cohesion; involved in chromosome segregation; mutant mcl1-1 display elongated heterogeneous telomeres; double mutant mcl1-1/rad3delta lethal; non-essential; double mutant mcl1-1/rad26delta lethal; mutant mcl1-1 displays acute sensitivity to DNA damage that affects S phase progression; involved in DNA repair; overexpression causes S phase delay; possibly involved in the regulation of DNA replication complexes; possibly involved in cytokinesis
Entry clone Cloned
ORF length (unspliced) 2551
ORF length (spliced) 2448
Entry clone length 2551
No. of intron 2
Sequence status Finished
Sequence results 1049T:C / 1666T:C / 1958T:A
Comments
Polymerase used for cloning Platinum Taq HiFi (Invitrogen)
Fwd primer name SPAPB1E7.02.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGGCAGGGAATAGGCTAGT
Rev primer name SPAPB1E7.02.Rv
Rev primer SEQ AGAAAGCTGGGTAGACGTTAGATAGTAGATTA
Amino acid length 815
Molecular weight 90.9
Isoelectric point (calc.) 4.9
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) none
Localization (YFP) nucleus
Comments for localization
Effect of LMB on protein localization no change
Microscope used for observation Leica

Image information
YFP 2 images) See all images

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.