Gene name |
SPAPB1E7.02c |
Gene ID |
49/E08 |
Gene synonyms/obsolete |
mcl1 |
Gene product |
WD repeat protein;
involved in DNA replication; interacts physically with DNA
polymerase alpha; involved in sister chromatid cohesion;
involved in chromosome segregation; mutant mcl1-1 display
elongated heterogeneous telomeres; double mutant
mcl1-1/rad3delta lethal; non-essential; double mutant
mcl1-1/rad26delta lethal; mutant mcl1-1 displays acute
sensitivity to DNA damage that affects S phase progression;
involved in DNA repair; overexpression causes S phase delay;
possibly involved in the regulation of DNA replication
complexes; possibly involved in cytokinesis |
Entry clone |
Cloned |
ORF length (unspliced) |
2551 |
ORF length (spliced) |
2448 |
Entry clone length |
2551 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1049T:C / 1666T:C /
1958T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB1E7.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGGGAATAGGCTAGT |
Rev primer name |
SPAPB1E7.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGACGTTAGATAGTAGATTA |
Amino acid length |
815 |
Molecular weight |
90.9 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |