| Gene name |
SPBC216.01c |
| Gene ID |
49/E10 |
| Gene synonyms/obsolete |
SPBC713.13c |
| Gene product |
eukaryotic conserved
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2569 |
| ORF length (spliced) |
2511 |
| Entry clone length |
2569 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
600T:C / 1143A:G /
1609T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC216.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTACGAAGGAAGA |
| Rev primer name |
SPBC216.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAAGCGTAGCCATTCTGG |
| Amino acid length |
836 |
| Molecular weight |
95.4 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSTFSELLNI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |