| Gene name |
SPAPB24D3.10c |
| Gene ID |
49/F05 |
| Gene synonyms/obsolete |
agl1; agl |
| Gene product |
alpha-glucosidase;
glycosyl hydrolase family 31; similar to Sp SPAC922.02c and
SPAC30D11.01c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2910 |
| ORF length (spliced) |
|
| Entry clone length |
2910 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
825T:C / 1014T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB24D3.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGATTTCTACTGCCTA |
| Rev primer name |
SPAPB24D3.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAAGTAAGATTCCAGCTG |
| Amino acid length |
969 |
| Molecular weight |
108.7 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAETIHGLRL/LANVTILGL |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |