Gene name |
SPAPB1A10.01c |
Gene ID |
49/F12 |
Gene synonyms/obsolete |
SPAP11E10.02c |
Gene product |
Sp specific families;
hypothetical protein; possibly Sp specific; serine-threonine
repeat containing protein; glycoprotein |
Entry clone |
Cloned |
ORF length (unspliced) |
3249 |
ORF length (spliced) |
|
Entry clone length |
3249 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
813A:G / 1394T:C /
2440A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB1A10.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGATTGCTTTGGCTTT |
Rev primer name |
SPAPB1A10.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAAACATCAACTACAGAA |
Amino acid length |
1082 |
Molecular weight |
109.1 |
Isoelectric point (calc.) |
3.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |