| Gene name |
SPAPB1A10.06c |
| Gene ID |
49/G04 |
| Gene synonyms/obsolete |
|
| Gene product |
DEAD/DEAH box
helicase; ATP-dependent; RNA helicase; ribonucleoprotein (RNP)
complex; processome component; involved in rRNA processing
|
| Entry clone |
Cloned# |
| ORF length (unspliced) |
3599 |
| ORF length (spliced) |
3552 |
| Entry clone length |
3599 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
328C:G / 3284T:A /
3286G:T / 3298T:G / 3299T:G |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPB1A10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAGACTGCGTAAAAG |
| Rev primer name |
SPAPB1A10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAATTCACCCAACGCCCA |
| Amino acid length |
1183 |
| Molecular weight |
133.9 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSPRFSKMLII |
| Localization (YFP) |
nucleolus>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |