| Gene name |
SPAC110.02 |
| Gene ID |
49/G06 |
| Gene synonyms/obsolete |
pds5 |
| Gene product |
cohesin-associated
protein; involved in sister chromatid cohesion; involved in
DNA repair; involved in DNA damage response (required);
involved in chromosome segregation (required); involved in
survival after metaphase arrest (required); interacts
physically with Eso1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3618 |
| ORF length (spliced) |
|
| Entry clone length |
3618 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
337A:G / 1495C:T /
2091A:deletion / 2859A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC110.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATAAAGTTACAGTTTCA |
| Rev primer name |
SPAC110.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAATCCTCTATTTCATCA |
| Amino acid length |
1205 |
| Molecular weight |
138.8 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
1137 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCCIVELLRL/LEDIFQVILKI/LMTLGQLFL/LTKLQKQLQL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |