Gene name |
SPAPB2C8.01 |
Gene ID |
49/G09 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
glycoprotein; threonine-rich protein; possibly Sp specific;
3kb of 36 AA repeat; agglutinin-like; similar to Sp
SPBC1348.08C |
Entry clone |
Cloned |
ORF length (unspliced) |
3663 |
ORF length (spliced) |
|
Entry clone length |
3663 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB2C8.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGTTTCCCGATTGCT |
Rev primer name |
SPAPB2C8.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTATCAATACCACCATTA |
Amino acid length |
1220 |
Molecular weight |
124 |
Isoelectric point (calc.) |
3.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ambiguous
structure |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |