Gene name |
SPAPB1E7.04c |
Gene ID |
49/G10 |
Gene synonyms/obsolete |
|
Gene product |
glycosyl hydrolase
family 18; glucoamylase I (alpha-1,4-glucan glucosidase);
extracellular starch-degrading enzyme; chitinase family
signature |
Entry clone |
Cloned |
ORF length (unspliced) |
3711 |
ORF length (spliced) |
|
Entry clone length |
3711 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1766G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB1E7.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGTTAATATCTTCTTT |
Rev primer name |
SPAPB1E7.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCGGCAGTGGTTGTTGCA |
Amino acid length |
1236 |
Molecular weight |
123.3 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
vacuole |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |