Gene name |
SPCC18B5.01c |
Gene ID |
49/H06 |
Gene synonyms/obsolete |
bfr1;hba2;
SPCPJ732.04c |
Gene product |
brefeldin A efflux
transporter; ABC transporter family; PDR subfamily; similar to
Sp SPAPB24D3.09c |
Entry clone |
Cloned |
ORF length (unspliced) |
4593 |
ORF length (spliced) |
|
Entry clone length |
4593 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
3462G:A / 3594T:C /
3857A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC18B5.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCAAAATTCGGATAC |
Rev primer name |
SPCC18B5.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACCAGTTCCGGTAATCTTT |
Amino acid length |
1530 |
Molecular weight |
171.7 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGGIGVLAI/LQFGFESLMI/LFDQFDRLLLL/LALDIFAGLFI |
Localization (YFP) |
periphery |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |