| Gene name |
SPCC18B5.01c |
| Gene ID |
49/H06 |
| Gene synonyms/obsolete |
bfr1;hba2;
SPCPJ732.04c |
| Gene product |
brefeldin A efflux
transporter; ABC transporter family; PDR subfamily; similar to
Sp SPAPB24D3.09c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4593 |
| ORF length (spliced) |
|
| Entry clone length |
4593 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
3462G:A / 3594T:C /
3857A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC18B5.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCAAAATTCGGATAC |
| Rev primer name |
SPCC18B5.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCAGTTCCGGTAATCTTT |
| Amino acid length |
1530 |
| Molecular weight |
171.7 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGGIGVLAI/LQFGFESLMI/LFDQFDRLLLL/LALDIFAGLFI |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |