Gene name |
SPAC4A8.11c |
Gene ID |
49/H08 |
Gene synonyms/obsolete |
fas2; lsd1 |
Gene product |
alpha fatty acid
synthase (subunit alpha) |
Entry clone |
Cloned |
ORF length (unspliced) |
5529 |
ORF length (spliced) |
|
Entry clone length |
5529 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1004T:C / 4380A:T /
4392C:T / 4393A:C / 4422T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4A8.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGACCAGAAGTTGAGCA |
Rev primer name |
SPAC4A8.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTGTGAGCCAAAGCAACA |
Amino acid length |
1842 |
Molecular weight |
202.1 |
Isoelectric point (calc.) |
6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LESVLLLAL/LYGQVLHALSL |
Localization (YFP) |
cytosol |
Comments for localization |
occasionally
cytoplasmic dots by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |