| Gene name |
SPAC4A8.11c |
| Gene ID |
49/H08 |
| Gene synonyms/obsolete |
fas2; lsd1 |
| Gene product |
alpha fatty acid
synthase (subunit alpha) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5529 |
| ORF length (spliced) |
|
| Entry clone length |
5529 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1004T:C / 4380A:T /
4392C:T / 4393A:C / 4422T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4A8.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGACCAGAAGTTGAGCA |
| Rev primer name |
SPAC4A8.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGTGAGCCAAAGCAACA |
| Amino acid length |
1842 |
| Molecular weight |
202.1 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LESVLLLAL/LYGQVLHALSL |
| Localization (YFP) |
cytosol |
| Comments for localization |
occasionally
cytoplasmic dots by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |