| Gene name |
SPBC32H8.13c |
| Gene ID |
49/H11 |
| Gene synonyms/obsolete |
mok12;
SPACTOKYO_453.25c |
| Gene product |
a-1,3-glucan synthase;
alpha glucan synthase; glycosyl transferase family 1; similar
to Sp MOK1 and MOK11 and MOK13 and MOK14; no apparent Sc
ortholog; involved in cell wall biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7059 |
| ORF length (spliced) |
|
| Entry clone length |
7059 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
3496T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC32H8.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCTTCTTTAGCATACC |
| Rev primer name |
SPBC32H8.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGCAAGCTGACTTTTA |
| Amino acid length |
2352 |
| Molecular weight |
266.5 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
14 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFFSIPTILLI/LEYDVPDLGI/LWSIIILLLI/LLSVIKILSL/LTKSVWLLLAL |
| Localization (YFP) |
Golgi; periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |