| Gene name |
SPCC737.08 |
| Gene ID |
50/A03 |
| Gene synonyms/obsolete |
|
| Gene product |
midasin; predicted
coiled-coil protein; involved in nuclear export; AAA family
ATPase; EF hand motif; calcium binding protein; Sc MDN1 is
null lethal |
| Entry clone |
Cloned |
| ORF length (unspliced) |
14154 |
| ORF length (spliced) |
|
| Entry clone length |
14154 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
7230T:G |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC737.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGTGTTGATTGAGTG |
| Rev primer name |
SPCC737.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTATTACTCATCTGCTGA |
| Amino acid length |
4717 |
| Molecular weight |
537.7 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGQRLWQILDL/LYQVAKSLSL/LAECLHKELHI/LERLNSVLEL/LRDTLRWLQL/LFNCLASLDL/LIEQIKVLDL/LKDAIDAILNL/LFNSMLSLQL/LNLMNFVLNL/LSIELCEQLRL/LALVTKALSL |
| Localization (YFP) |
SPB; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |