| Gene name |
SPBC660.07 |
| Gene ID |
50/A10 |
| Gene synonyms/obsolete |
ntp1 |
| Gene product |
O-glycosyl hydrolase;
neutral trehalase; alpha,alpha-trehalose glucohydrolase;
glycosyl hydrolase family 37; involved in trehalose
metabolism; involved in stress response (required); involved
in sporulation (implicated); complexed with Tps1p; calcium
binding protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2208 |
| ORF length (spliced) |
|
| Entry clone length |
2208 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC660.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTCGAAATTTTCCTC |
| Rev primer name |
SPBC660.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTTATGAATGGAAAGG |
| Amino acid length |
735 |
| Molecular weight |
84.6 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSNLLQELTL/LPAFENLSI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
DeltaVision |