Gene name |
SPBC1105.18c |
Gene ID |
50/B06 |
Gene synonyms/obsolete |
SPBC887.21c |
Gene product |
peptidyl tRNA
hydrolase; peptide release factor |
Entry clone |
Cloned |
ORF length (unspliced) |
489 |
ORF length (spliced) |
|
Entry clone length |
489 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
25T:C / 80T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1105.18.Fd |
Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGCTGTGCGCAGCACGAAA |
Rev primer name |
SPBC1105.18.Rv |
Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGATCACGTCTTGTTTCGCT |
Amino acid length |
162 |
Molecular weight |
18.8 |
Isoelectric point (calc.) |
10.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
127 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |