| Gene name |
SPBC1703.01c |
| Gene ID |
50/B11 |
| Gene synonyms/obsolete |
SPBP4H10.22c |
| Gene product |
nuclear exosome (RNase
complex); RNase MRP component; RNase P component; involved in
rRNA processing; involved in tRNA processing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
726 |
| ORF length (spliced) |
654 |
| Entry clone length |
726 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1703.01.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGCTGATCCACTATACTC |
| Rev primer name |
SPBC1703.01.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGAGATCTATTGTATTTTTC |
| Amino acid length |
217 |
| Molecular weight |
24.6 |
| Isoelectric point (calc.) |
10.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
68 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLVPSLNL |
| Localization (YFP) |
nucleolus with
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |