| Gene name |
SPBC32H8.12c |
| Gene ID |
50/C12 |
| Gene synonyms/obsolete |
cps8; act1;
pi012 |
| Gene product |
actin; essential;
actin filament component; actin cortical patch component;
involved in cytokinesis; involved in cell polarity; involved
in contractile ring assembly; cytoskeleton protein;
overexpression results in cell cycle defects; sensitive to the
spindle poison isopropyl N-3-chlorophenyl carbamate |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1128 |
| ORF length (spliced) |
|
| Entry clone length |
1128 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC32H8.12.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGAAGAAGAAATCGCAGC |
| Rev primer name |
SPBC32H8.12.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGAAGCACTTACGGTAAACG |
| Amino acid length |
375 |
| Molecular weight |
41.7 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPHAIMRLDL |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |