| Gene name |
SPBC11B10.09 |
| Gene ID |
50/D08 |
| Gene synonyms/obsolete |
cdc2; swo2; pi002;
SPACTOKYO_453.34 |
| Gene product |
serine/threonine
protein kinase; cyclin-dependent protein kinase; essential;
regulates cell cycle transition G1/S; regulates cell cycle
transition G2/M; G2/M Cdc2p CDK associates with Cdc13p; G2/M
Cdc2p CDK complex is inhibited by Tyr15 phosphorylation during
G2 phase; Cdc2p CDK complex is inhibited by Tyr15
phosphorylation by DNA replication/DNA damage checkpoint
activation; G1/S promoting complex; involved in the regulation
of CDK activity; involved in control of mitosis; involved in
DNA damage checkpoint; involved in DNA replication
checkpoint |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1189 |
| ORF length (spliced) |
894 |
| Entry clone length |
1189 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC11B10.09.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGAGAATTATCAAAAAGT |
| Rev primer name |
SPBC11B10.09.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAATGAAAATCACGAAGATAA |
| Amino acid length |
297 |
| Molecular weight |
34.3 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |