Gene name |
SPBP22H7.09c |
Gene ID |
50/F02 |
Gene synonyms/obsolete |
pi022;
SPACTOKYO_453.12 |
Gene product |
involved in chromosome
segregation |
Entry clone |
Cloned |
ORF length (unspliced) |
1341 |
ORF length (spliced) |
1236 |
Entry clone length |
1341 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
66T:C / 104A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP22H7.09.Fd |
Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGCGTACTGAATTGTCTAG |
Rev primer name |
SPBP22H7.09.Rv |
Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGTTAATCTCTTGTTGTCCG |
Amino acid length |
411 |
Molecular weight |
47.7 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGQIAQLEI/LPNPLVFLEL |
Localization (YFP) |
SPB; nuclear dots;
nucleus |
Comments for localization |
nuclear dots by over
expression? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |