| Gene name |
SPCPB16A4.02c |
| Gene ID |
50/F08 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
pleckstrin homology domain; same domain arrangement as human
platelet p47 protein; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1389 |
| ORF length (spliced) |
987 |
| Entry clone length |
1389 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
574A:T / 699G:T /
746G:T / 1134T:C / 1151G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCPB16A4.02.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGACCCAGGAGTTTCATC |
| Rev primer name |
SPCPB16A4.02.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAACAAGCAGTAAAAGTACCA |
| Amino acid length |
328 |
| Molecular weight |
37.6 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |