| Gene name |
SPAPB17E12.04c |
| Gene ID |
50/G06 |
| Gene synonyms/obsolete |
csn2 |
| Gene product |
COP9/signalosome
complex (subunit 2); PCI domain; involved in DNA damage
checkpoint; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1488 |
| ORF length (spliced) |
1314 |
| Entry clone length |
1488 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
1452A:G |
| Comments |
Mixture of 2 clones?
One may have a 426G:A mutation. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB17E12.04.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGTCTAATGATTTTATGCT |
| Rev primer name |
SPAPB17E12.04.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTACTTCGTGGCAGTATTCCAC |
| Amino acid length |
437 |
| Molecular weight |
51.3 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |