Gene name |
SPAPB1A10.11c |
Gene ID |
50/H06 |
Gene synonyms/obsolete |
|
Gene product |
glutamyl-tRNA
synthetase; involved in glutamyl-tRNA aminoacylation;
glutamate-tRNA ligase activity |
Entry clone |
Cloned# |
ORF length (unspliced) |
1581 |
ORF length (spliced) |
|
Entry clone length |
1581 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAPB1A10.11.Fd |
Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGCTCTCTTATACCTCTTG |
Rev primer name |
SPAPB1A10.11.Rv |
Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTATACGATACAACTTCTTTTG |
Amino acid length |
526 |
Molecular weight |
60.6 |
Isoelectric point (calc.) |
9.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |