| Gene name |
SPBC359.01 |
| Gene ID |
51/A03 |
| Gene synonyms/obsolete |
SPBPB10D8.08 |
| Gene product |
amino acid permease;
amino acid permease family; similar to Sp SPAP7G5.06 and
SPAC869.11 and meu22 and SPBPB2B2.01 and isp5 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1746 |
| ORF length (spliced) |
|
| Entry clone length |
1746 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
513A:G / 1507T:C /
1511T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC359.01.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGTCACATAGCGATTACAA |
| Rev primer name |
SPAC359.01.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGCAAACGGCATTCCATGCT |
| Amino acid length |
581 |
| Molecular weight |
63.6 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNYFVTCPLEL |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |