Gene name |
SPBC29A10.12 |
Gene ID |
51/B10 |
Gene synonyms/obsolete |
|
Gene product |
conserved eukaryotic
protein; no apparent Sc ortholog |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
732 |
ORF length (spliced) |
624 |
Entry clone length |
732 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
Mixture |
Comments |
Mixture of 2 clones,
one of which is frameshifted from 79. |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC29A10.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAATCCAAAAAAGAG |
Rev primer name |
SPBC29A10.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCGCGTAAACGTGCTTCC |
Amino acid length |
207 |
Molecular weight |
24 |
Isoelectric point (calc.) |
10.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
4/22 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
too dark to
photo |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |