Gene name |
SPBC29A10.09c |
Gene ID |
51/D05 |
Gene synonyms/obsolete |
|
Gene product |
CAF1 family
ribonuclease; R3H domain; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1283 |
ORF length (spliced) |
|
Entry clone length |
1283 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC29A10.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAAAACTTTTTAGAG |
Rev primer name |
SPBC29A10.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTGCAATATTTATTTAGG |
Amino acid length |
427 |
Molecular weight |
49 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Zeiss |