| Gene name |
SPCC548.03c |
| Gene ID |
51/D11 |
| Gene synonyms/obsolete |
wtf4; wtf13 |
| Gene product |
pseudogene; wtf
element |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1503 |
| ORF length (spliced) |
1092 |
| Entry clone length |
1503 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
325A:addition/
326A:addition/ 327A:addition |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC548.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAAAGATTATCC |
| Rev primer name |
SPCC548.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACTTCGCTTTCAACATCC |
| Amino acid length |
363 |
| Molecular weight |
40.1 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
a few cytoplasmic
dots; vacuole |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |