Gene name |
SPAC11E3.13c |
Gene ID |
52/B02 |
Gene synonyms/obsolete |
|
Gene product |
GPI anchored protein
(pers. comm. Birgit Eisenhaber); GAS family; involved in cell
wall organization and biogenesis (maintenance); glycoprotein;
similar to Sp SPBC342.03 |
Entry clone |
Cloned |
ORF length (unspliced) |
1533 |
ORF length (spliced) |
|
Entry clone length |
1533 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC11E3.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACTTCCTCCATTTTTT |
Rev primer name |
SPAC11E3.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAAAAACAAGTCCGCTA |
Amino acid length |
510 |
Molecular weight |
53.6 |
Isoelectric point (calc.) |
4.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHFLTTSLLL/LPYLQGLNI |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |