| Gene name |
SPAC959.10 |
| Gene ID |
52/C07 |
| Gene synonyms/obsolete |
|
| Gene product |
tRNA-splicing
endonuclease (subunit); similar to S. cerevisiae
YMR059W |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
432 |
| ORF length (spliced) |
|
| Entry clone length |
432 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC959.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAACATAATACATTTCT |
| Rev primer name |
SPAC959.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTTCATCATTTTGCCTT |
| Amino acid length |
|
| Molecular weight |
|
| Isoelectric point (calc.) |
|
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |