Gene name |
SPBC16E9.16c |
Gene ID |
52/C11 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan; has protein product on MS analysis |
Entry clone |
#Not cloned yet |
ORF length (unspliced) |
2271 |
ORF length (spliced) |
1929 |
Entry clone length |
2077 |
No. of intron |
2 |
Sequence status |
#Not cloned yet |
Sequence results |
#Not cloned yet |
Comments |
ORF prediction was
wrong. |
Polymerase used for cloning |
|
Fwd primer name |
SPBC16E9.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAAAACCTTCTGGCAA |
Rev primer name |
SPBC16E9.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTGTTGGACATACCCAAG |
Amino acid length |
642 |
Molecular weight |
70.2 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
|
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
Localization (YFP) |
not cloned |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|