Gene name |
SPCC1223.15c |
Gene ID |
52/E04 |
Gene synonyms/obsolete |
spc19 |
Gene product |
DASH complex
subunit |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
548 |
ORF length (spliced) |
447 |
Entry clone length |
548 |
No. of intron |
2 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1223.15c.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTATTTGGATGGGTA |
Rev primer name |
SPCC1223.15c.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATGACCTCGTTTTTGTTG |
Amino acid length |
148 |
Molecular weight |
17 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
|
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
Localization (YFP) |
Not determined |
Comments for localization |
|
Effect of LMB on protein
localization |
Not determined |
Microscope used for
observation |
|