Gene name |
SPAC27E2.12 |
Gene name |
SPAC27E2.12 |
Gene ID |
52/E08 |
Gene ID |
52/E08 |
Gene synonyms/obsolete |
|
Gene product |
dubious |
Gene product |
dubious |
Entry clone |
Cloned in 2006
trial |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
405 |
ORF length (unspliced) |
405 |
ORF length (spliced) |
231 |
ORF length (spliced) |
231 |
Entry clone length |
405 |
Entry clone length |
405 |
No. of intron |
1 |
No. of intron |
1 |
Sequence status |
Partially
sequenced |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Sequence results |
100% match in both
ends |
Comments |
|
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC27E2.12.Fd |
Fwd primer name |
SPAC27E2.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTATACAAGGACTAGT |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTATACAAGGACTAGT |
Rev primer name |
SPAC27E2.12.Rv |
Rev primer name |
SPAC27E2.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGCTTTCATATTTTCCAC |
Rev primer SEQ |
AGAAAGCTGGGTAATGCTTTCATATTTTCCAC |
Amino acid length |
76 |
Amino acid length |
76 |
Molecular weight |
8.7 |
Molecular weight |
8.7 |
Isoelectric point (calc.) |
8 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
Signal SEQ |
|
No. of transmembrane domain |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
|
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
Localization (YFP) |
Not determined |
Localization (YFP) |
Not determined |
Comments for localization |
|
Comments for localization |
|
Effect of LMB on protein
localization |
Not determined |
Effect of LMB on protein
localization |
Not determined |
Microscope used for
observation |
|
Microscope used for
observation |
|