Gene name |
SPCC1393.12 |
Gene ID |
01/G11 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan |
Entry clone |
Cloned |
ORF length (unspliced) |
327 |
ORF length (spliced) |
|
Entry clone length |
327 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1393.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAGGCGTGTTACTCT |
Rev primer name |
SPCC1393.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAACCATTTTGAGGTACCC |
Amino acid length |
108 |
Molecular weight |
12 |
Isoelectric point (calc.) |
10.2 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |