| Gene name |
SPAC31A2.13c |
| Gene ID |
01/G12 |
| Gene synonyms/obsolete |
sft1 |
| Gene product |
SNARE; 1 predicted
transmembrane helix; required for the transport of proteins
between an early and a later Golgi compartment; seems to act
as a vesicle soluble NSF attachment protein receptor (v-SNARE)
(By similarity) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
330 |
| ORF length (spliced) |
276 |
| Entry clone length |
330 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
110A:G /
137A:addition |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC31A2.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGATCAAAATGAGCG |
| Rev primer name |
SPAC31A2.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAAACCATTTGGATGCA |
| Amino acid length |
91 |
| Molecular weight |
10.5 |
| Isoelectric point (calc.) |
10.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAIVGSILII |
| Localization (YFP) |
ER; Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |