Gene name |
SPAC17H9.11 |
Gene ID |
03/E02 |
Gene synonyms/obsolete |
|
Gene product |
cofilin/tropomyosin-type actin binding protein;
similar to Sc YDR063W |
Entry clone |
Cloned |
ORF length (unspliced) |
426 |
ORF length (spliced) |
|
Entry clone length |
426 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
(-5)C:deletion |
Comments |
5' terminus is
frameshifted. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17H9.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATCAGAGGCTCGTAT |
Rev primer name |
SPAC17H9.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGCAAAAACTCATCAACT |
Amino acid length |
141 |
Molecular weight |
16.2 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |