| Gene name |
SPAC2G11.08c |
| Gene ID |
05/B03 |
| Gene synonyms/obsolete |
smn1; yab8 |
| Gene product |
orthologue of the
human SMN protein; involved in mRNA processing; involved in
snRNP biogenesis; essential; no apparent Sc ortholog;
overexpression results in increased growth rate; functionally
complemented by overexpression of murine Smn |
| Entry clone |
Cloned |
| ORF length (unspliced) |
518 |
| ORF length (spliced) |
459 |
| Entry clone length |
518 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
407A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2G11.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACCAGAGCCAAAAAGA |
| Rev primer name |
SPAC2G11.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTTACGTTGCTCACTT |
| Amino acid length |
152 |
| Molecular weight |
17.3 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |