| Gene name |
SPCP31B10.08c |
| Gene ID |
05/B02 |
| Gene synonyms/obsolete |
rpl35a; rpl33 |
| Gene product |
60S ribosomal protein
L35a |
| Entry clone |
Cloned |
| ORF length (unspliced) |
517 |
| ORF length (spliced) |
327 |
| Entry clone length |
517 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
(-8)G:addition /
19A:T |
| Comments |
5' terminus is
frameshifted. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCP31B10.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAGCTCAAGGACATAG |
| Rev primer name |
SPCP31B10.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGTTGGAGGGGTAAAGC |
| Amino acid length |
108 |
| Molecular weight |
12.1 |
| Isoelectric point (calc.) |
11.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |