| Gene name |
SPBC29A3.08 |
| Gene ID |
06/F06 |
| Gene synonyms/obsolete |
pof4 |
| Gene product |
F-box protein; elongin
A transcription elongation factor |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
600 |
| ORF length (spliced) |
|
| Entry clone length |
600 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
485C:addition |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC29A3.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATTCTTTAAAAGATTT |
| Rev primer name |
SPBC29A3.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGGACGCTTTGTAGAAGT |
| Amino acid length |
199 |
| Molecular weight |
22.9 |
| Isoelectric point (calc.) |
10.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
135 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDVLLLTLLIL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|