| Gene name |
SPAC22E12.05c |
| Gene ID |
06/G09 |
| Gene synonyms/obsolete |
rer1 |
| Gene product |
ER lumen protein
retaining receptor activity; involved in intracellular protein
transport; involved in protein-ER retention; involved in ER to
Golgi transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
608 |
| ORF length (spliced) |
555 |
| Entry clone length |
608 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
320A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22E12.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTCATTCAGCGTCA |
| Rev primer name |
SPAC22E12.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTGTGAGCCAAATTTTTTC |
| Amino acid length |
184 |
| Molecular weight |
22.3 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAIYLLNLFL |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |