| Gene name |
SPBP8B7.24c |
| Gene ID |
06/H05 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in autophagy;
involved in attachment of autophagosomes to microtubules;
microtubule-associated protein; involved in sporulation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
613 |
| ORF length (spliced) |
366 |
| Entry clone length |
613 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
44A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP8B7.24.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTCTCAATTCAAGGA |
| Rev primer name |
SPBP8B7.24.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAGGAAACACTGTTCCA |
| Amino acid length |
121 |
| Molecular weight |
14.1 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|