| Gene name |
SPAC2C4.10c |
| Gene ID |
07/A08 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned |
| ORF length (unspliced) |
622 |
| ORF length (spliced) |
501 |
| Entry clone length |
622 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
252T:C / 528A:G /
618C:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2C4.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGAGCTTCATCCTGA |
| Rev primer name |
SPAC2C4.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGCTCTTCTTCAAGGCTC |
| Amino acid length |
166 |
| Molecular weight |
19.6 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNKMQKELDL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |