| Gene name |
SPAC20G4.06c |
| Gene ID |
07/B10 |
| Gene synonyms/obsolete |
cof1; adf1 |
| Gene product |
experimentally
characterised; cofilin; actin-binding protein;
cofilin/tropomyosin-type; involved in actin filament
depolymerization; involved in actin filament fragmentation;
actin cortical patch component |
| Entry clone |
Cloned |
| ORF length (unspliced) |
628 |
| ORF length (spliced) |
414 |
| Entry clone length |
628 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC20G4.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTATGAAATATTTTTGT |
| Rev primer name |
SPAC20G4.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTACGAGTAACCTTCTCA |
| Amino acid length |
137 |
| Molecular weight |
15.6 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEAFQELKL |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |