Gene name |
SPAC24B11.03 |
Gene ID |
07/C02 |
Gene synonyms/obsolete |
aps1;
SPAC13G6.14 |
Gene product |
diadenosine
5',5'''-p1,p6-hexaphosphate hydrolase; dual function MutT
hydrolase; involved in inositol polyphosphate hydrolysis;
non-essential; deletion mutant results in decreased in vitro
Ap6A hydrolase activity; degrades PP-InsP5; degrades
[PP]x-InsPx |
Entry clone |
Cloned |
ORF length (unspliced) |
633 |
ORF length (spliced) |
|
Entry clone length |
633 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
449T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC24B11.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTGAAAATAACGGAAG |
Rev primer name |
SPAC24B11.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTTTCCTCTTTAATGATA |
Amino acid length |
210 |
Molecular weight |
23.7 |
Isoelectric point (calc.) |
10.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
173 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |