| Gene name |
SPBC11G11.06c |
| Gene ID |
07/C01 |
| Gene synonyms/obsolete |
sme1 |
| Gene product |
small nuclear
ribonucleoprotein E; involved in mRNA splicing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
630 |
| ORF length (spliced) |
255 |
| Entry clone length |
630 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC11G11.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGGACGCGTGCAAAA |
| Rev primer name |
SPBC11G11.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGATTGCTTGAATTAGTGTA |
| Amino acid length |
84 |
| Molecular weight |
9.6 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |