Gene name |
SPCC16C4.03 |
Gene ID |
07/G06 |
Gene synonyms/obsolete |
pin1 |
Gene product |
peptidyl-prolyl
cis-trans isomerase; WW domain which binds specifically to
phospho-Ser/Thr-Pro sequences; non-essential; overexpression
results in slow growth and G1 delay; functionally complements
Sc ESS1 |
Entry clone |
Cloned |
ORF length (unspliced) |
673 |
ORF length (spliced) |
528 |
Entry clone length |
673 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC16C4.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTAATACTGGGTTACC |
Rev primer name |
SPCC16C4.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCGTGTCTTTGAATGATG |
Amino acid length |
175 |
Molecular weight |
19.7 |
Isoelectric point (calc.) |
8.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |