Gene name |
SPBC336.13c |
Gene ID |
07/H09 |
Gene synonyms/obsolete |
|
Gene product |
mitochondrial inner
membrane peptidase complex; signal peptidase activity;
involved in mitochondrial processing |
Entry clone |
Cloned |
ORF length (unspliced) |
682 |
ORF length (spliced) |
543 |
Entry clone length |
682 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC336.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAACCCTTTCGTTCG |
Rev primer name |
SPBC336.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTAACAGAACGTTTTCCA |
Amino acid length |
180 |
Molecular weight |
20.5 |
Isoelectric point (calc.) |
10.6 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |