Gene name |
SPCC1450.03 |
Gene ID |
08/F01 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan |
Entry clone |
Cloned in 2004
trial/#check (not sequenced before) |
ORF length (unspliced) |
723 |
ORF length (spliced) |
|
Entry clone length |
723 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1450.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGCCACAACCGGTAA |
Rev primer name |
SPCC1450.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCGAGATTTGCGACTAGTT |
Amino acid length |
240 |
Molecular weight |
27 |
Isoelectric point (calc.) |
3.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LINMQPSLAI |
Localization (YFP) |
nucleus>>cytosol; SPB? |
Comments for localization |
interphase SPB? |
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol;
SPB?) |
Microscope used for
observation |
DeltaVision |