Gene name |
SPBC1683.10c |
Gene ID |
08/F10 |
Gene synonyms/obsolete |
|
Gene product |
DUF125; 8 predicted
transmembrane helices; similar to S. cerevisiae
YLR220W; involved in calcium ion homeostasis |
Entry clone |
Cloned |
ORF length (unspliced) |
729 |
ORF length (spliced) |
|
Entry clone length |
729 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1683.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGGAGTATATTCGAAGC |
Rev primer name |
SPBC1683.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATATTGCGTACTGCAAGGAT |
Amino acid length |
242 |
Molecular weight |
25.6 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LITPLEYLSL/LLEIHALSL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |