Gene name |
SPBC336.08 |
Gene ID |
09/F02 |
Gene synonyms/obsolete |
|
Gene product |
spindle pole body
protein; similar to S. cerevisiae YMR117C; coiled-coil;
centromere component (GFP) |
Entry clone |
Cloned |
ORF length (unspliced) |
774 |
ORF length (spliced) |
597 |
Entry clone length |
774 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC336.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGACAGTCCAATTGA |
Rev primer name |
SPBC336.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTTTGTCCTTACTATCA |
Amino acid length |
198 |
Molecular weight |
23 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; SPB |
Comments for localization |
cytoplasmic dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |