| Gene name |
SPAC17G6.09 |
| Gene ID |
10/F01 |
| Gene synonyms/obsolete |
sec62 |
| Gene product |
SRP receptor activity;
involved in intracellular protein transport; involved in
protein-ER targeting; involved in SRP-dependent
cotranslational membrane targeting |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
822 |
| ORF length (spliced) |
|
| Entry clone length |
822 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC17G6.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTTCTAATGTACC |
| Rev primer name |
SPAC17G6.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCAGAGACTTCTTCGACG |
| Amino acid length |
273 |
| Molecular weight |
31.5 |
| Isoelectric point (calc.) |
10.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFALVVLALVL |
| Localization (YFP) |
ER |
| Comments for localization |
accumulated ER by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |