| Gene name |
SPAC1952.02 |
| Gene ID |
10/E12 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical; similar
to Sp SPAC890.05 (a G-patch domain) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
754 |
| ORF length (spliced) |
609 |
| Entry clone length |
754 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1952.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTAGTTCCAAAAGATA |
| Rev primer name |
SPAC1952.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCCTTTACCTTTTTAGTA |
| Amino acid length |
202 |
| Molecular weight |
22.8 |
| Isoelectric point (calc.) |
10.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
155/157/158/173 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |